СПОСОБ ОПРЕДЕЛЕНИЯ ЦИТОКИНОВОГО СТАТУСА ЧЕЛОВЕКА НА ГЕНЕТИЧЕСКОМ УРОВНЕ - Патенты - Каталог статей - Клинико - диагностическая лаборатория
Среда, 07.12.2016, 18:20
| RSS
Главная | Каталог статей
Меню сайта
Категории раздела
статьи [155]
Нормативные документы Украины [45]
Нормативные документы Казахстана [4]
Накази Мінпраці та соцполітики [3]
Патенты [68]
Нормативные документы Российской Федерации [34]
клінічні протоколи лікування хвороб [19]
авторефераты диссертаций [4]
Нормативные документы Беларуси [21]
Нормативные документы СССР [19]
Полезные ресурсы
Мир лаборатории
Медицинский форум
МедЛабДиагностика
Туберкулез предстательной железы
Каталоги
Яндекс цитирования Рейтинг@Mail.ru
Статистика
Клиническая лабораторная диагностика
Главная » Статьи » Патенты

СПОСОБ ОПРЕДЕЛЕНИЯ ЦИТОКИНОВОГО СТАТУСА ЧЕЛОВЕКА НА ГЕНЕТИЧЕСКОМ УРОВНЕ
Номер патента: 2181773
Класс(ы) патента: C12Q1/00, C12Q1/68, C07K14/52, C07K14/56, C07K14/565, C07K14/57
Номер заявки: 2000106253/13
Дата подачи заявки: 16.03.2000
Дата публикации: 27.04.2002
Заявитель(и): Научно-исследовательский институт вирусологии им. Д.И. Ивановского РАМН
Автор(ы): Соколова Т.М.; Урываев Л.В.
Патентообладатель(и): Научно-исследовательский институт вирусологии им. Д.И. Ивановского РАМН
Суть изобретения: Изобретение относится к области молекулярной биологии, иммунологии, микробиологии и вирусологии и предназначено для оценки транскрипционных уровней активности генов интерферонов (ИФ), ИФ-зависимых и пролиферативных цитокинов. Способ включает определение информационных РНК (иРНК) цитокинов на основе сочетания методов ОТ-ПЦР с блот- и дотгибридизацией. При этом для выявления изменений в цитокиновом статусе исследуют спектр иРНК интерферон (ИФ)-зависимых и пролиферативных цитокинов: интерферонов (альфа-2, бета-1 и гамма), ИФ-регулируемых ферментов: 2',5'-олигоаденилатсинтетазы (2,5-ОАС), РНК-азы L, дс-протеинкиназы (дсПк), факторов клеточной пролиферации: Всl-2, Fas-антигена (Fas-АГ) и белка цитоскелета - гамма-актина, с помощью синтетических олигонуклеотидов. Использование данного способа в клинических исследованиях дает необходимую информацию о существующих взаимосвязях в сети ИФ-зависимых цитокиновых реакций клеток в норме и при различных патологических состояниях. 2 ил., 2 табл.
Описание изобретения:

Изобретение относится к области молекулярной биологии, иммунологии, микробиологии и вирусологии и предназначено для оценки активности генов цитокинов.
Цитокины - многочисленное семейство ростовых белковых факторов, управляющих процессами активации, пролиферации и дифференцировки клеток (Кашкин К. П. Цитокины иммунной системы: основные свойства и иммунобиологическая активность. Клиническая лабораторная диагностика, 1, 1998, с.21-32). Интерфероны (ИФ) были первыми выявленными представителями этого семейства. Многие из цитокинов известны как интерлейкины, которые определяют реактивность иммунной системы, влияя на представление антигенов, цитотоксические реакции, уровень дифференцировки и пролиферации иммукомпетентных клеток (Т- и В-лимфоцитов, макрофагов и др.). Наиболее значимыми эффектами действия ИФ являются: антивирусное, антипролиферативное, иммунорегуляторное и гормоноподобное. ИФ видоспецифичны и проявляют активность в клетках гомологичных видов. Подобно ряду известных цитокинов, ИФ вызывают в клетках усиление или подавление активности группы клеточных генов (Ершов Ф.И. Система интерферона в норме и патологии. М. , Медицина, 1996; Vilcek J. a. Sen G.C. Interferons and other cytokines. In "Fundamental Virology", p.341-345, New-York, 1996). Среди активируемых клеточных генов часть генов имеет преимущественную связь с системой ИФ и получила название ИФ-зависимых. К ним относятся гены и информационные РНК (иРНК) ферментов: 2'-5'-олигоаденилатсинтетазы (2-5-ОАС), рибонуклеазы L (РНК-аза L) и двухспиральной РНКпротеинкиназы(дсПК), которые контролируют процессы клеточной пролиферации и дифференцировки и играют ведущую роль в развитии антивирусного и антипролиферативного состояний (Sen G.C. a. Lengyel P. , The interferonsystem. A birds eye view of its biochemistry. J. Biol. Chem. , V.267, p.5017-5020, 1992; Lengyel P. Tumor-suppressor genes; News about the interferon connections. Proc. Natl. Acad. Sci. USA, V.90, p. 5893-5895, 1993). Наряду с ИФ-зависимыми ферментами к белкам, регулирующим процессы клеточной пролиферации (КП) и апоптоза относятся протонкоген Всl-2, Fas-антиген (Fas-АГ) (White Е. Life, death and the pursuit of apoptosis. Genes Dev., V.10, p.1-15, 1996). Высокий уровень содержания Bcl-2 считается показателем клеточной пролиферации, и, наоборот, накопление Fas-антигена индуцирует процессы, приводящие к гибели клеток (Schwatzman R.A., Cidlowski J. A. Apoptosis: The biochemistry and molecular biology of programmed cell death. Endocrine Rev., V.14, p.133-151, 1993). Показатели активности генов белков, участвующих в митозе и в построении клеточного цитоскелета, например гамма-актина, важны для характеристики процессов клеточной пролиферации (Erba Н.Р., Eddy R., Shows T. et. al. Structure. Chromosome localization and expression of the human gamma-actin gene. Mol. Cell. Biol., V.8, p.1775-1789, 1988).
В понятие "цитокиновый статус" нами объединены показатели активности цитокинов систем интерферона (ИФ) и клеточной пролиферации (КП), которые определяют нормальные физиологические реакции организма в ответ на внешние воздействия разной природы, включая лекарственную терапию, вирусные и бактериальные инфекции. Системы ИФ и КП тесно связаны между собой и с системой иммунитета. Между ними имеется сложный сетевой механизм регуляции. Система ИФ состоит из взаимосвязанных последовательных стадий: индукции, синтеза и действия. В результате индукции генов ИФ происходит транскрипция иРНК ИФ и синтез белков ИФ, которые секретируются из клеток. Последующее действие ИФ осуществляют, взаимодействуя с рецепторами окружающих клеток и индуцируя в них ряд клеточных генов и транскрипцию с них иРНК, из которых наиболее изучены вышеназванные ферменты и белки клеточной пролиферации.
ИФ принято подразделять на 2 основных типа и 3 вида: к типу I ИФ относят лейкоцитарный (альфа) и фибробластный (бета); тип II представлен одним видом - иммунным (гамма-ИФ). ИФ (альфа, бета и гамма) кодируются разными генами, причем многочисленные подвиды альфа-ИФ (около 20) достаточно консервативны по первичной структуре (60-70% гомологии). Наоборот, между генами альфа и бета ИФ гомология низкая. Более того, гены бета-1 ИФ и бета-2 ИФ (интерлейкин 6) имеют мало сходства. В настоящее время расшифрованы первичные структуры иРНК 3-х видов человеческих ИФ и нескольких ИФ-зависимых и пролиферативных белков, исследованных нами (таблица 1).
Активно разрабатывается обратная транскрипция - полимеразная цепная реакция (ОТ-ПЦР) - метод определения иРНК разных видов интерлейкинов и факторов воспаления, для которых применяются качественные и количественные варианты (Oka M. , Hirose К., Ilzuka N. et. al. Cytokine mRNA expression patterns in human esоphageal cancer cell lines. J. Interferon and Cytokine Res., V.15, p. 1005-1009, 1995; Platzer С., Blankenstein Т. Polymerase chain reaction to quantitate cytokine mRNA. In: Cytokines. A practical approch. Ed. F.R. Barkwill. IRL Press, Ox-ford, N-Y, Tokyo, 1995).
Известны изобретения, описывающие несколько вариантов ОТ-ПЦР для сравнительного определения иРНК в разных видах клеток и тканей (Klotman P.E. et. al. , патент США 5543509, 6 авг. 1996; Pardee et. al., патент США 5665547, 9 сент. 1997; Banker et. al., патент США 5643730, 1 июля 1997; Sutcliffe et. al., патент США 5807680, 15 сент. 1998). В отличие от них предлагаемый способ определения имеет отношение к специальной группе малоизученных иРНК цитокинов, кодирующих синтез ИФ, ИФ-регулируемых ферментов и белков КП (таблица 1). В настоящее время коммерческие ОТ-ПЦР наборы для определения ИФ-зависимых и пролиферативных иРНК отсутствуют. Отдельные фирмы предлагают только иммуноферментные тест-системы для определения белков системы иммунитета (факторов воспаления) (смотри каталог "Genzym diagnostics", 1995). Поэтому патентуемый способ с набором оригинальных специфических олигонуклеотидов для определения в биологических средах (системах) иРНК цитокинов систем ИФ и КП заполнит пробел в необходимых ПЦР-диагностикумах. К существенным признакам изобретения, отличающим его от ранее опубликованных, относятся:
1. Полуколичественное определение спектра (набора) иРНК белков систем ИФ и КП в биологических средах (системах), в том числе микрообразце периферической крови человека. Это достигается превращением разных видов полиаденилатсодержащих РНК /поли(А) РНК/ в комплементарные ДНК (кДНК) в реакции ОТ с последующей амплификацией специфических участков ДНК методом ПЦР с парой олигонуклеотидных праймеров и гибридизацией разведений ДНК-продуктов с мечеными радиоактивными зондами. (см. описание процедуры определения).
2. Использование набора оригинальных олигонуклеотидных праймеров и зондов к участкам иРНК цитокинов человека, кодирующих синтез: 3-х видов ИФ (альфа-2, бета-1 и гамма), 5-ти ИФ-регулируемых и пролиферативных белков (2,5-ОАС, РНК-азы L, дс-ПК, Всl-2, Fas-АГ) и белка цитоскелета - гамма-актина.
Сущность патентуемого способа определения заключается в том, что проводится сравнительный анализ уровней транскрипции спектра иРНК ИФ, ИФ-зависимых и пролиферативных цитокинов в биологических средах, в том числе в микропробе крови человека, на основе объединения полуколичественного варианта метода ОТ-ПЦР с методами блот- и дотгибридизации. Для 9-ти видов иРНК цитокинов человека нами рассчитаны и синтезированы специфические олигонуклеотиды (ПЦР-праймеры и гибридизационные зонды) размером 21-24 нуклеотида. Описание первичной структуры олигонуклеотидных праймеров и зондов для определения 9 видов иРНК ИФ-зависимых и пролиферативных цитокинов патентуемым способом приведено в таблице 1. Проведен компьютерный анализ специфичности олигонуклеотидов, который позволил исключить взаимодействие их с гетерологичными матрицами в условиях ПЦР. При сравнении нуклеотидных последовательностей иРНК ИФ для расчета праймеров были выбраны участки, отличающиеся у иРНК для альфа-2, бета-1 и гамма-ИФ. Праймеры и зонды для человеческой иРНК Всl-2 и иРНК гамма-актина взаимодействуют с иРНК аналогичных цитокинов мышиного происхождения и потому могут иметь более широкое видовое использование.
Патентуемый способ включает комплекс ранее известных молекулярных методов определения иРНК и ДНК, имеющих высокую специфичность, чувствительность и наглядность. Способ позволяет определять содержание иРНК ИФ-регулируемых генов человека, имеющих высокие, средние и низкие уровни экспрессии. Внедрение его в клинические исследования даст необходимую информацию о существующих взаимосвязях в сети ИФ-зависимых цитокиновых реакций клеток в норме и при различных патологических состояниях. Предлагаемый способ сделает технологичным комплексное сравнительное изучение влияния любых лекарственных средств, в первую очередь препаратов ИФ и его индукторов, на экспрессию генов систем ИФ и КП (публикации в литературе подобных исследований нам неизвестны). Особенно актуально сравнительное изучение экспрессии генов систем ИФ и КП у онкологических больных, а также и у лиц с хроническими вирусными и бактериальными инфекциями.
ОПИСАНИЕ ПРОЦЕДУРЫ ОПРЕДЕЛЕНИЯ
Для определения используется полуколичественный вариант сочетанного метода обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР), обладающий высокой чувствительностью (Dallman P.J., Porte А. С. In: PCR. A Practical Approch, Lond. , 1991, р.215-224). Пробы свежей крови объемом 0,2 мл (сразу после взятия из вены) смешивали с равным объемом 2-кратного буфера лизиса (1•4 М гуанидинтиоцианат, 25 мМ Na цитрат (SSC), рН 7,0, 0,5% саркозил, 100 мМ меркаптоэтанол). Пробы хранили при -20oС. Выделение иРНК проводили по описанному в литературе методу (Chomzynsky P. and Sacchi N., Anal. Biochem. V.162, p.152-159, 1987). РНК последовательно переосаждали 70% этанолом, 3 М ацетатом аммония и повторно 70% этанолом.
Суммарная РНК, выделенная из 0,2 мл крови, добавляется в реакцию обратной транскрипции для синтеза комплементарной ДНК (кДНК). В качестве универсального праймера используется олигодезокситимидиловая кислота /олиго(дТ)16/, которая взаимодействует со всеми поли(А)РНК в суммарном препарате РНК. Далее синтезированная смесь кДНК разводится в 10 и более раз для проведения ПЦР со специфическими олигонуклеотидами (парами праймеров), рассчитанными по известным первичным структурам иРНК исследуемых цитокинов с помощью компьютерной программы "Олиго 3.4" (таблица 1). ОТ-ПЦР осуществляли в 2 этапа:
1) ОТ - реакция с универсальным праймером олиго(дТ) на суммарной поли(А)РНК с целью получения кДНК. Состав реакционной смеси объемом 40 мкл: клеточная РНК 1-10 мкг, праймер олиго(дТ)16 5 мкг, смесь: дАТФ, дГТФ, дЦТФ и дТТФ - каждого по 1 мМ, фермент - обратная транскриптаза M-MULV (Moloney Murine Leukemia Virus "MBI Fermentas") 40 ед, ингибитор РНК-азы (RNAsin "MBI Fermentas") 30 ед; 5-кратный буфер 8 мкл (состав однократного: 50 мМ трис-НСl, рН 8,0, 10 мМ MgCl2, 14 мМ KCl, 10 мМ дитиотриэтол). Смесь инкубировали 1 ч при 40oС на водяной бане. Реакцию останавливали нагреванием при 94oC 3 минуты.
2) ПЦР-амплификация 10-кратных разведений кДНК, полученных в реакции ОТ, термостабильным ферментом Taq-полимераза ("МВI Fermetas") со специфическими парами (прямой и обратный) олигонуклеотидных праймеров на приборе ДНК-амплификатор по программе: Т плавления 94oС, 1 мин, Т отжига (установленная для каждой пары праймеров), Т амплификация - 72oС, 2 мин. Количество циклов ПЦР варьировали от 30 до 50 (в зависимости от накопления специфического ДНК-продукта). Время проведения ПЦР составляло 3-5 ч. Для предотвращения испарения реакционной пробы сверху добавляли вазелиновое масло. Состав смеси инкубации ПЦР объемом 20 мкл: разведения кДНК (10-кратные), праймеры прямой и обратный по 1 мкл (1-2 ОЕ/мл), смесь: дАТФ, дГТФ, дЦТФ и дТТФ - каждого по 1 мМ, 10-кратный буфер 2 мкл (состав однократного: 67 мМ трис-HCl, рН 8,8; 16,6 мМ сульфат аммония; 2 мМ MgCl2; 0,1% твин-20, фермент ДНКполимераза Thermus aqaticus (Taq-полимераза) 2,5-5 ед.
Полученные ДНК-продукты размером 200-600 нуклеотидов определяют электрофорезом в 1,4% агарозном геле (80V, 1 ч) по окраске бромистым этидием визуально (фиг. A I, II, III и Б I, II, III). Специфичность полученных ДНК-продуктов оценивают по:
- соответствию подвижности в геле ДНК-амплификатов размеру исследованных участков иРНК цитокинов;
- блотгибридизации на мембранах амплификатов ДНК с радиоактивно-мечеными 32Р зондами к внутренним участкам иРНК цитокинов.
Количественную оценку накопления специфических продуктов осуществляют в дотгибридизации авторадиографической регистрацией взаимодействия 10-кратных разведений амплификатов ДНК с мечеными 32Р-зондами.
Блот- и дотгибридизацию выполняли в 50% формамиде на мембранах (Hybond-N, "Amersham") по методикам, рекомендованным фирмой "Promega". ПЦР-продукты переносили на мембраны, денатурировали 0,5 М NaOH, нейтрализовали 0,5 М трис-HCl, рН 7,0, нагревали при 80oС в течение 2 ч. Мембраны сначала инкубировали в прегибридизационном буфере 2 ч, а затем в гибридизационном буфере (50% формамид, 6 X SSC, 1% додецилсульфат Na (SDS), 0,1% твин-20, 100 мкг/мл ДНК спермы лосося) с меченым радиоактивным 32Р-зондом (100 млн расп./мкг) в течение 19 ч в термостате при оптимальных для каждого зонда температурах взаимодействия (Т С рассчитаны с помощью программы "Олиго 3.4"). Мембраны последовательно отмывали от несвязанной радиоактивности в 1X и 0,1X SSC 2-3 раза. Подсушенную мембрану авторадиографировали с рентгеновской пленкой 18 ч.
Пример 1. Полуколичественная оценка конститутивных уровней содержания иРНК цитокинов систем ИФ и КП в микропробах крови человека.
Кровь брали из локтевой вены 2-х здоровых доноров. Аликвоту крови (0,2 мл) смешивали с равным объемом 2-кратного лизирующего буфера и хранили при -20oС. Использовали метод выделения РНК (Chomczynski P. a. Sacchi N. Single-step method of RNA isolation by acid guanidinium thi-ocyante-phenol-chloroform extraction. Anal. Biochem. 162, 156-159, 1987). На 2-х образцах выделенных суммарных РНК в независимых реакциях ОТ с универсальным праймером олиго(дТ)16 были синтезированы препараты кДНК. Аликвоты кДНК (неразведенной и разведенной 1/10-1/1000) добавляли в 9 независимых реакций ПДР (каждая с парой специфических олигонуклеотидных праймеров). Программы ПЦР отличались Т С отжига праймеров на матрицах кДНК (указаны для каждой использованной пары праймеров в таблице 1) и числом циклов амплификации, необходимых для накопления визуально выявляемых количеств ДНК электрофорезом в агарозном геле (окраска бромистым этидием). У 2-х пациентов в исследованных пробах крови получены совпадающие результаты конститутивных уровней содержания иРНК, которые суммированы в таблице 2. Согласно полученным данным конститутивные уровни содержания иРНК разных видов цитокинов в образцах крови пациентов значительно варьируют. Сопоставление количеств ДНК-продуктов, полученных с разведениями кДНК, позволяет разделить иРНК цитокинов на группы с очень высокими (альфа-2-ИФ), высокими (РНК-аза L, гамма-актин, BcL-2), средним (бета-1-ИФ) и низкими (не выявляемыми) уровнями транскрипции (гамма-ИФ, 2,5-ОАС, дсПК, Fas-АГ). Более чем 1000-кратное превышение уровня иРНК альфа-ИФ над иРНК бета- и гамма-ИФ дает основание предположить, что в лейкоцитах крови гены альфа-ИФ могут быть активированы в высокой степени. Высокое содержание иРНК РНКазы L, гамма-актина и Всl-2 также свидетельствует о повышенной активности генов этих цитокинов в клетках крови. Предлагаемый способ определения цитокинового статуса можно использовать для оценки клинической эффективности лекарственных средств в организме человека путем сравнительного индивидуального анализа изменений в уровнях накопления иРНК ИФ-регулируемых и пролиферативных цитокинов в клетках крови.
Пример 2. Выявление изменений в уровнях синтеза иРНК альфа-2-ИФ и бета-1-ИФ в клетках крови пациентов после введения иммуномодулятора и индуктора ИФ.
Пробы венозной крови (0,2 мл) брали у 2-х пациентов за 1 ч и через 24 и 48 ч после введения препаратов. Постановка полуколичественной ОТ-ПЦР была аналогичной описанной выше при определении конститутивных уровней иРНК цитокинов. Дополнительно специфичность полученных ДНК-амплификатов устанавливалась методами блот- и дотгибридизации с радиоактивными 32Р-зондами, рассчитанными к внутренним последовательностям 9-ти видов иРНК цитокинов (таблица 1). Для блотгибридизации агарозные гели с выявленными ДНК-продуктами переносили на мембраны Hybond-N в течение 18 ч под давлением. Для дотгибридизации ДНК-амплификаты из смеси ПЦР сначала осаждали 75% этанолом, затем разводили в 10 и более раз и наносили по 1 мкл на мембраны Hybond-N. Процедура гибридизации с мечеными зондами описана выше. Количественная оценка накопления специфических ДНК-продуктов сделана по их разведениям, выявляемым авторадиографией на рентгеновских пленках. Результаты по выявлению изменений уровней синтеза иРНК цитокинов у 2-х пациентов, получавших препарат Т-иммуномодулятор (пациент 1) или препарат Ц-индуктор ИФ (пациент 2), представлены на фиг.А и Б. Обнаружены незначительные индивидуальные вариации (в пределах 10 раз) в исходных уровнях транскрипции иРНК альфа-2-ИФ у пациентов 1 и 2. Более существенные отличия имелись в уровнях транскрипции иРНК бета-1-ИФ и гамма-ИФ. У пациента 1 (по данным блотгибридизации) содержание иРНК бета-1-ИФ было почти в 100 раз выше, чем у пациента 2 (вероятно это связано с особенностями выявленного у него инфекционного заболевания). Особенность экспрессии гена бета-1-ИФ состоит в наличии промежуточных иРНК транскриптов, которые, по данным литературы, являются этапами созревания конечной формы иРНК в клетках человека. Данные электрофореза ДНК-продуктов в агарозном геле, блот- и дотгибридизации показывают изменения в уровнях транскрипции иРНК после введения препаратов. Препарат Т вызывает сильное подавление экспрессии гена бета-1-ИФ, т.к. специфический ДНК-продукт /393 нуклеотидные пары (н. п.)/ не определялся через 24 и 48 ч. Наоборот, препарат Ц стимулировал транскрипционную активность гена бета-1-ИФ более чем в 100 раз (количественная оценка по данным дотгибридизации). Эффект индукции гена бета-1-ИФ препаратом Ц исчезал к 48 ч, что может быть объяснено быстрым выведением препарата из организма. Препарат Т (пациент 1) угнетал транскрипцию иРНК альфа-2-ИФ, а препарат Ц (пациент 2) стимулировал ее приблизительно в 10 раз к 24 ч. Выраженность эффектов препаратов Т и Ц на активность гена альфа-2-ИФ была существенно меньше, чем на активность гена бета-1-ИФ. Проведенная нами сравнительная оценка клинической эффективности действия 2-х препаратов демонстрирует высокую информативность патентуемого способа для выявления изменений в цитокиновом статусе человека на генетическом уровне.
Таким образом, экспериментальная проверка патентуемого способа показала его применимость для определения конститутивных и меняющихся (под действием лекарственных средств) уровней экспрессии генов ряда ИФ-зависимых и пролиферативных цитокинов человека в микропробе крови комбинацией полуколичественного метода ОТ-ПЦР, блот- и дотгибридизации с использованием специфических олигонуклеотидных праймеров и гибридизационных зондов.
Формула изобретения: Полуколичественный способ оценки уровней транскрипционной активности генов в биологических системах путем определения информационных РНК (иРНК) цитокинов на основе сочетания методов ОТ-ПЦР с блот- и дотгибридизацией, отличающийся тем, что определение проводят в микропробе (0,2 мл) крови человека и для выявления изменений в цитокиновом статусе исследуют спектр иРНК интерферон (ИФ)-зависимых и пролиферативных цитокинов: интерферонов (альфа-2, бета-1 и гамма), ИФ-регулируемых ферментов: 2', 5'-олигоаденилатсинтетазы (2,5-ОАС), РНК-азы L, дс-протеинкиназы (дсПк), факторов клеточной пролиферации: Всl-2, Fas-антигена (Fas-АГ) и белка цитоскелета - гамма-актина, с помощью синтетических олигонуклеотидов:
праймеров из 21 звена с нуклеотидной последовательностью
GGCCTTGATACTCCTGGCACA и AGGCACAAGGGCTGTATTTCT
и гибридизационного зонда из 21 звена с нуклеотидной последовательностью
GAGCCTTCTGGAACTGGTTGC,
взаимодействующих с иРНК альфа-2 ИФ; праймеров из 21 звена с нуклеотидной последовательностью
TGCAGCAGTTCCAGAAGGAGG и TCCAGTCCCAGAGGCACAGGC
и гибридизационного зонда из 24 звеньев с нуклеотидной последовательностью
CCTGGAAGAAAAACTGGAGAAAGA,
взаимодействующих с иРНК бета-1 ИФ; праймеров из 21 звена с нуклеотидной последовательностью
GGTTCTCTTGGCTGTTACTGC и GCAGGCAGGACAACCATTACT
и гибридизационного зонда из 24 звеньев с нуклеотидной последовательностью
GACCAGAGCATCCAAAAGAGTGTG,
взаимодействующих с иРНК гамма ИФ; праймеров из 21 звена с нуклеотидной последовательностью
TCGGGGAGGGGGTGGAGTTCG и GCTCACTGGGGACCCATCCCA
и гибридизационного зонда из 24 звеньев с нуклеотидной последовательностью
GCCCAGGGATTTCGGACGGTCTTG,
взаимодействующих с иРНК 2,5-ОАС; праймеров из 21 звена с нуклеотидной последовательностью
TGCATCGGGGGTGCATGGGCC и CTTCACGCTCCGCCTTCTCGT
и гибридизационного зонда из 24 звеньев с нуклеотидной последовательностью
CCTGTCCTCTGGTTCTTTTGCTAC,
взаимодействующих с иРНК дс-ПК; праймеров из 21 звена с нуклеотидной последовательностью
AGAGGAAGGGGGCTGGACACC и GCGTTTACATCTGCCCCCATC
и гибридизационного зонда из 21 звена с нуклеотидной последовательностью
TCACGCTCCCCGCAATCGCTG,
взаимодействующих с иРНК РНК-азы L; праймеров из 23 звеньев с нуклеотидной последовательностью
TGAGACTCAGAACTTGGAAGGCC и TGCCACTGTTTCAGGATTTAAGG
и гибридизационного зонда из 23 звеньев с нуклеотидной последовательностью
TTCTGCCATAAGCCCTGTCCTCC,
взаимодействующих с иРНК Fas-АГ; праймеров из 21 звена с нуклеотидной последовательностью
TGCACCTGACGCCCTTCACCG и CCAGGTGTGCAGGTGCCGGTT
и гибридизационного зонда из 24 звеньев с нуклеотидной последовательностью
CCTCCCCCAGTTCACCCCGTCCCT,
взаимодействующих с иРНК Всl-2; праймеров из 21 звена с нуклеотидной последовательностью
GGGCGACCACTGGCATTGTC и GCGGTGGACGATGGAGGGGCC
и гибридизационного зонда из 21 звена с нуклеотидной последовательностью
ACCGGAACCGCTCATTGCCAA,
взаимодействующих с иРНК гамма-актина.

Просмотров: 1243
Холодняк Любовь Владимировна
Хостинг от uCoz@Холодняк Любовь Владимировна